Mature sequence cre-miR1157-3p

Accession numberMIMAT0005408
IDcre-miR1157-3p
Previous IDscre-miR1157
Stem-Loop cre-MIR1157
Sequence
uucagguagcgggaccaggug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:17538623 "miRNAs control gene expression in the single-cell alga Chlamydomonas reinhardtii" Molnar A, Schwach F, Studholme DJ, Thuenemann EC, Baulcombe DC Nature. 447:1126-1129(2007).