Mature sequence xtr-miR-181a-2-3p

Accession numberMIMAT0005461
IDxtr-miR-181a-2-3p
Previous IDsxtr-miR-181a-2*
Stem-Loop xtr-mir-181a-2
Sequence
accaucggccguugacuguacc
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1