Mature sequence xtr-miR-181a-2-3p

Accession numberMIMAT0005461
IDxtr-miR-181a-2-3p
Previous IDsxtr-miR-181a-2*
Sequence
accaucggccguugacuguacc
Get sequence
Stem-Loop xtr-mir-181a-2

References

1