Mature sequence xtr-miR-18a-3p

Accession numberMIMAT0005462
IDxtr-miR-18a-3p
Previous IDsxtr-miR-18a*
Sequence
acugcccuaagugcuccuucu
Get sequence
Stem-Loop xtr-mir-18a

References

1