Mature sequence xtr-miR-18a-3p

Accession numberMIMAT0005462
IDxtr-miR-18a-3p
Previous IDsxtr-miR-18a*
Stem-Loop xtr-mir-18a
Sequence
acugcccuaagugcuccuucu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1