Accession | MIMAT0005480 |
Description | dme-miR-965-3p mature miRNA |
Hairpins | |
Sequence | UAAGCGUAUAGCUUUUCCCCUU |
Evidence |
experimental
454 [1-2], Illumina [2] |
Database links | |
Predicted targets |
QuickGO is a fast web-based browser of the Gene Ontology and Gene Ontology annotation data.
Qualifier | GO term | Evidence | Reference | Annotation Extension |
---|---|---|---|---|
enables | GO:1903231 mRNA base-pairing translational repressor activity |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26226636 | |
involved_in | GO:0007488 histoblast morphogenesis |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26226636 | |
involved_in | GO:0035279 miRNA-mediated gene silencing by mRNA destabilization |
ECO:0000314 direct assay evidence used in manual assertion |
PMID:26226636 | |
involved_in | GO:0071390 cellular response to ecdysone |
ECO:0000315 mutant phenotype evidence used in manual assertion |
PMID:26226636 |