Mature sequence dme-miR-992-3p

Accession numberMIMAT0005510
IDdme-miR-992-3p
Previous IDsdme-miR-992
Stem-Loop dme-mir-992
Sequence
aguacacguuucugguacuaag
Get sequence
Deep sequencing3158 reads, 22 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:17989254 "Evolution, biogenesis, expression, and target predictions of a substantially expanded set of Drosophila microRNAs" Ruby JG, Stark A, Johnston WK, Kellis M, Bartel DP, Lai EC Genome Res. 17:1850-1864(2007).