Mature sequence xtr-miR-146b

Accession numberMIMAT0005563
IDxtr-miR-146b
Sequence
ugagaacugaauuccauggacu
Get sequence
Stem-Loop xtr-mir-146b

References

1