Mature sequence xtr-miR-320

Accession numberMIMAT0005564
IDxtr-miR-320
Stem-Loop xtr-mir-320
Sequence
aaaagcuggguugagagguga
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1