Mature sequence xtr-miR-375

Accession numberMIMAT0005565
IDxtr-miR-375
Sequence
uuuguucguucggcucgcguua
Get sequence
Stem-Loop xtr-mir-375

References

1