Mature sequence xtr-miR-427

Accession numberMIMAT0005566
IDxtr-miR-427
Sequence
gaaagugcuuucuguuuugggcg
Get sequence
Stem-Loop xtr-mir-427-1 xtr-mir-427-2 xtr-mir-427-3

References

1