Mature sequence rno-miR-146b-5p

Accession numberMIMAT0005595
IDrno-miR-146b-5p
Previous IDsrno-miR-146b
Stem-Loop rno-mir-146b
Sequence
ugagaacugaauuccauaggcugu
Get sequence
Deep sequencing572386 reads, 503 experiments
Predicted targets

References

1
PMID:17805466 "Cloning and identification of novel microRNAs from rat hippocampus" He X, Zhang Q, Liu Y, Pan X Acta Biochim Biophys Sin (Shanghai). 39:708-714(2007).
2
PMID:20403161 "Small RNA expression and strain specificity in the rat" Linsen SE, de Wit E, de Bruijn E, Cuppen E BMC Genomics. 11:249(2010).