Mature sequence ptr-miR-510

Accession numberMIMAT0005775
IDptr-miR-510
Stem-Loop ptr-mir-510
Sequence
uacccaggagaguggcaaucaca
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:17416744 "Rapid evolution of an X-linked microRNA cluster in primates" Zhang R, Peng Y, Wang W, Su B Genome Res. 17:612-617(2007).