Mature sequence hsa-miR-1264

• Accession number: MIMAT0005791
• ID: hsa-miR-1264
• Stem-Loop: hsa-mir-1264
• Sequence: caagucuuauuugagcaccuguu
• Deep sequencing: 1029 reads, 42 experiments
• Predicted targets:
  • TargetMiner:hsa-miR-1264
  • TargetScanVert:hsa-miR-1264
  • miRDB:hsa-miR-1264
  • microrna.org:hsa-miR-1264

References

1. PMID:16954537 "Many novel mammalian microRNA candidates identified by extensive cloning and RAKE analysis" Berezikov E, van Tetering G, Verheul M, van de Belt J, van Laake L, Vos J, Verloop R, van de Wetering M, Guryev V, Takada S, van Zonneveld AJ, Mano H, Plasterk R, Cuppen E Genome Res. 16:1289-1298(2006).
2. PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).