Mature sequence hsa-miR-548l

Accession numberMIMAT0005889
IDhsa-miR-548l
Stem-Loop hsa-mir-548l
Sequence
aaaaguauuugcggguuuuguc
Get sequence
Deep sequencing2117 reads, 109 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).