Mature sequence hsa-miR-1249-3p

Accession numberMIMAT0005901
IDhsa-miR-1249-3p
Previous IDshsa-miR-1249
Stem-Loop hsa-mir-1249
Sequence
acgcccuucccccccuucuuca
Get sequence
Deep sequencing4756 reads, 152 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).