Mature sequence hsa-miR-1265

Accession numberMIMAT0005918
IDhsa-miR-1265
Stem-Loop hsa-mir-1265
Sequence
caggauguggucaaguguuguu
Get sequence
Deep sequencing11 reads, 8 experiments
Predicted targets

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).