Mature sequence hsa-miR-1255b-5p

Accession numberMIMAT0005945
IDhsa-miR-1255b-5p
Previous IDshsa-miR-1255b
Stem-Loop hsa-mir-1255b-1 hsa-mir-1255b-2
Sequence
cggaugagcaaagaaagugguu
Get sequence
Deep sequencing8361 reads, 111 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18285502 "Application of massively parallel sequencing to microRNA profiling and discovery in human embryonic stem cells" Morin RD, O'Connor MD, Griffith M, Kuchenbauer F, Delaney A, Prabhu AL, Zhao Y, McDonald H, Zeng T, Hirst M, Eaves CJ, Marra MA Genome Res. 18:610-621(2008).