Mature sequence odi-miR-92a

Accession numberMIMAT0006080
IDodi-miR-92a
Stem-Loop odi-mir-92a
Sequence
uauugcacucgucccggccuug
Get sequence
Deep sequencing reads, experiments

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).