Mature sequence cin-let-7a-5p

Accession numberMIMAT0006086
IDcin-let-7a-5p
Previous IDscin-let-7a
Stem-Loop cin-let-7a-1 cin-let-7a-2
Sequence
ugagguaguagguuaugcagu
Get sequence
Deep sequencing18406 reads, 2 experiments

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).
2