Mature sequence cin-let-7e

Accession numberMIMAT0006090
IDcin-let-7e
Stem-Loop cin-let-7e
Sequence
ugagguaguugguuguaucggu
Get sequence
Deep sequencing1111 reads, 2 experiments

References

1
PMID:18339653 "Altered miRNA repertoire in the simplified chordate, Oikopleura dioica" Fu X, Adamski M, Thompson EM Mol Biol Evol. 25:1067-1080(2008).