Mature sequence mml-let-7d

Accession numberMIMAT0006154
IDmml-let-7d
Stem-Loop mml-let-7d
Sequence
agagguaguagguugcauaguu
Get sequence
Deep sequencing476886 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1