Mature sequence mml-miR-34c-5p

Accession numberMIMAT0006175
IDmml-miR-34c-5p
Stem-Loop mml-mir-34c
Sequence
aggcaguguaguuagcugauugc
Get sequence
Deep sequencing1101193 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1