Mature sequence mml-miR-299-5p

Accession numberMIMAT0006255
IDmml-miR-299-5p
Stem-Loop mml-mir-299
Sequence
ugguuuaccgucccacauacau
Get sequence
Deep sequencing2536 reads, 9 experiments
Predicted targets

References

1