Mature sequence mml-miR-299-3p

Accession numberMIMAT0006256
IDmml-miR-299-3p
Stem-Loop mml-mir-299
Sequence
uaugugggacgguaaaccgcuu
Get sequence
Deep sequencing33882 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1