Mature sequence mml-miR-302d

Accession numberMIMAT0006262
IDmml-miR-302d
Stem-Loop mml-mir-302d
Sequence
uaagugcuuccauguuugagugu
Get sequence
Deep sequencing11 reads, 5 experiments
Predicted targets

References

1