Mature sequence mml-miR-375

Accession numberMIMAT0006302
IDmml-miR-375
Stem-Loop mml-mir-375
Sequence
uuuguucguucggcucgcguga
Get sequence
Deep sequencing10255 reads, 9 experiments
Predicted targets

References

1