Mature sequence mml-miR-383

Accession numberMIMAT0006312
IDmml-miR-383
Stem-Loop mml-mir-383
Sequence
agaucagaaggugauuguggcu
Get sequence
Deep sequencing17501 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1