Mature sequence mml-miR-490-5p

Accession numberMIMAT0006350
IDmml-miR-490-5p
Stem-Loop mml-mir-490
Sequence
ccauggaucuccaggugggu
Get sequence
Deep sequencing1019 reads, 7 experiments
Predicted targets

References

1