Mature sequence mml-miR-490-3p

Accession numberMIMAT0006351
IDmml-miR-490-3p
Stem-Loop mml-mir-490
Sequence
caaccuggaggacuccaugcug
Get sequence
Deep sequencing2874 reads, 7 experiments
Predicted targets

References

1