Mature sequence mml-miR-499-5p

Accession numberMIMAT0006361
IDmml-miR-499-5p
Stem-Loop mml-mir-499
Sequence
uuaagacuugcagugauguuu
Get sequence
Deep sequencing320223 reads, 9 experiments
Database links
Predicted targets
QuickGO function

References

1