Mature sequence mml-miR-499-3p

Accession numberMIMAT0006362
IDmml-miR-499-3p
Stem-Loop mml-mir-499
Sequence
aacaucacagcaagucugugcu
Get sequence
Deep sequencing1585 reads, 7 experiments
Predicted targets

References

1