Mature sequence mml-miR-612

Accession numberMIMAT0006464
IDmml-miR-612
Stem-Loop mml-mir-612
Sequence
cuggggagggcuucugagcuccu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1