Mature sequence mml-miR-615-5p

Accession numberMIMAT0006465
IDmml-miR-615-5p
Stem-Loop mml-mir-615
Sequence
ggggguccccggugcucggauc
Get sequence
Deep sequencing118 reads, 3 experiments
Predicted targets

References

1