Mature sequence mml-miR-615-3p

Accession numberMIMAT0006466
IDmml-miR-615-3p
Stem-Loop mml-mir-615
Sequence
uccgagccugggucucccucuu
Get sequence
Deep sequencing404 reads, 7 experiments
Predicted targets

References

1