Mature sequence cfa-let-7a

Accession numberMIMAT0006594
IDcfa-let-7a
Stem-Loop cfa-let-7a-1 cfa-let-7a-2
Sequence
ugagguaguagguuguauaguu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18215311 "miRNAminer: a tool for homologous microRNA gene search" Artzi S, Kiezun A, Shomron N BMC Bioinformatics. 9:39(2008).
2
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).