Mature sequence cfa-let-7e

Accession numberMIMAT0006608
IDcfa-let-7e
Stem-Loop cfa-let-7e
Sequence
ugagguaggagguuguauaguu
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18392026 "Discovering microRNAs from deep sequencing data using miRDeep" Friedlander MR, Chen W, Adamidi C, Maaskola J, Einspanier R, Knespel S, Rajewsky N Nat Biotechnol. 26:407-415(2008).