Mature sequence oan-miR-490-5p

Accession numberMIMAT0006810
IDoan-miR-490-5p
Previous IDsoan-miR-490
Stem-Loop oan-mir-490
Sequence
ccauggaucuccaggugggu
Get sequence
Deep sequencing109 reads, 4 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).