Mature sequence oan-miR-490-3p

Accession numberMIMAT0006811
IDoan-miR-490-3p
Previous IDsoan-miR-490*
Stem-Loop oan-mir-490
Sequence
caaccuggaggacuccaugcugu
Get sequence
Deep sequencing238 reads, 3 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).