Mature sequence oan-miR-1341

Accession numberMIMAT0006872
IDoan-miR-1341
Stem-Loop oan-mir-1341
Sequence
gugcgugaugacaacuuuggccgu
Get sequence
Deep sequencing360 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).