Mature sequence oan-miR-92b

Accession numberMIMAT0006918
IDoan-miR-92b
Stem-Loop oan-mir-92b
Sequence
uauugcacuugucccagccugu
Get sequence
Deep sequencing52250 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).