Mature sequence oan-miR-142-5p

Accession numberMIMAT0006982
IDoan-miR-142-5p
Previous IDsoan-miR-142
Stem-Loop oan-mir-142
Sequence
cauaaaguagaaagcacuacu
Get sequence
Deep sequencing2056 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).