Mature sequence oan-miR-142-3p

Accession numberMIMAT0006983
IDoan-miR-142-3p
Previous IDsoan-miR-142*
Stem-Loop oan-mir-142
Sequence
uguaguguuuccuacuuuaugg
Get sequence
Deep sequencing15204 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).