Mature sequence oan-let-7e-3p

Accession numberMIMAT0006985
IDoan-let-7e-3p
Previous IDsoan-let-7e*
Stem-Loop oan-let-7e
Sequence
cuauacaaucuacugucuuucc
Get sequence
Deep sequencing658 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).