Mature sequence oan-let-7g-5p

Accession numberMIMAT0007038
IDoan-let-7g-5p
Previous IDsoan-let-7g
Stem-Loop oan-let-7g
Sequence
ugagguaguaguuuguacaguu
Get sequence
Deep sequencing7624474 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).