Mature sequence oan-miR-221-5p

Accession numberMIMAT0007134
IDoan-miR-221-5p
Previous IDsoan-miR-221*
Stem-Loop oan-mir-221
Sequence
accuggcauacaauguagaau
Get sequence
Deep sequencing101197 reads, 5 experiments
Database links
QuickGO function

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).