Mature sequence oan-miR-98

Accession numberMIMAT0007178
IDoan-miR-98
Stem-Loop oan-mir-98
Sequence
ugagguaguaaguuguauuguu
Get sequence
Deep sequencing5647000 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).