Mature sequence oan-miR-32-3p

Accession numberMIMAT0007269
IDoan-miR-32-3p
Previous IDsoan-miR-32*
Stem-Loop oan-mir-32
Sequence
caauuuagugugugcgauauu
Get sequence
Deep sequencing33 reads, 5 experiments

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).