Mature sequence gga-miR-1397-5p

Accession numberMIMAT0007283
IDgga-miR-1397-5p
Previous IDsgga-miR-1397
Stem-Loop gga-mir-1397
Sequence
ugcauugcgacggguuauauca
Get sequence
Deep sequencing190 reads, 3 experiments
Database links
Predicted targets
QuickGO function

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).