Mature sequence gga-miR-1397-3p

Accession numberMIMAT0007284
IDgga-miR-1397-3p
Previous IDsgga-miR-1397*
Stem-Loop gga-mir-1397
Sequence
gauguaacccaacgcagcauga
Get sequence
Deep sequencing79 reads, 2 experiments
Predicted targets

References

1
PMID:18463306 "Conservation of small RNA pathways in platypus" Murchison EP, Kheradpour P, Sachidanandam R, Smith C, Hodges E, Xuan Z, Kellis M, Grutzner F, Stark A, Hannon GJ Genome Res. 18:995-1004(2008).
2
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).