Mature sequence gga-miR-1577

Accession numberMIMAT0007438
IDgga-miR-1577
Stem-Loop gga-mir-1577
Sequence
cucagggguggaaguaggagaa
Get sequence
Deep sequencing reads, experiments
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).