Mature sequence gga-miR-1791-3p

Accession numberMIMAT0007705
IDgga-miR-1791-3p
Previous IDsgga-miR-1791
Stem-Loop gga-mir-1791
Sequence
gcgaugugacugaugcaggcug
Get sequence
Deep sequencing278 reads, 5 experiments
Predicted targets

References

1
PMID:18469162 "A microRNA catalog of the developing chicken embryo identified by a deep sequencing approach" Glazov EA, Cottee PA, Barris WC, Moore RJ, Dalrymple BP, Tizard ML Genome Res. 18:957-964(2008).